lum viroid I (PlVd-I) was recently identified as a new viroid in 2020 present in Japanese plum (Prunus salicina) displaying marbling and corky flesh symptoms (Bester et al. 2020). This viroid is a member of the species Apscaviroid plvd-I (genus Apscaviroid, family Pospiviroidae) (Walker et al. 2022). The first observation of apricot fruits with an uneven, indented surface and irregular shape was in 2003 on Prunus armeniaca cv. ‘Charisma’ in the Western Cape, South Africa. The symptomatic apricot Charisma scions showed symptoms only on the fruits, resembling the marbling disease deformities reported previously on fruits from PlVd-I-infected plum trees. In the summer of 2019, representative leaf samples were collected from 13 ‘Charisma’ apricot trees (seven symptomatic and six healthy trees) from two different apricot orchards on two geographically separated farms in the Western Cape. Total RNA was extracted from 1 g of leaf petioles using a modified CTAB extraction protocol (Ruiz-García et al. 2019). Ribo-depleted RNA (RiboMinus Plant Kit for RNA-Seq, ThermoFisher Scientific) was prepared, and a sequencing library (Ion Total RNA-Seq Kit v2.0, ThermoFisher Scientific) was constructed from a symptomatic sample (La4) (Central Analytical Facility, Stellenbosch University, CAF-SU). High-throughput sequencing was performed on an Ion Torrent Proton instrument (CAF-SU). De novo assembly using SPAdes 3.13.0 (default parameters) (Nurk et al. 2013) was performed using 93,760,198 reads (average read length: 143 nt). The 174,679 scaffolds obtained were annotated using BLAST + standalone against a local NCBI nucleotide database. One scaffold (443 nt, read coverage: 23.88) had the highest sequence identity (99.59%) to multiple PlVd-I isolates and two scaffolds of 1,440 nucleotides (nt) and 2,143 nt had high sequence identity to RNA1 and RNA2 of solanum nigrum ilarvirus 1 (SnIV1) (MN216370: 98%; MN216373: 98%) (Ma et al. 2020). These were the only viral sequences identified in the sample. Consensus sequences for SnIV1 were generated by read mapping using CLC Genomics Workbench 11.0.1 (Qiagen) (default parameters) to SnIV1 (MN216370; MN216373; MN216376) and deposited in GenBank (MT900926 to MT900928). To confirm the presence of both PlVd-I and the apricot variant of SnIV1, reverse transcription polymerase chain reactions (RT-PCRs) were performed on the RNA of the 13 samples collected. The samples were tested for PlVd-I using primer set 22F/21R (Bester et al. 2020). Only the symptomatic samples tested positive for PlVd-I, providing the first evidence of PlVd-I related symptoms in apricots. Three PlVd-I amplicons were bidirectionally Sanger sequenced (CAF-SU) and submitted to GenBank (MT385845 to MT385847). The HTS PlVd-I sequence from sample La4 was 100% identical to MT385845, and 99.37% identical to MT385846 and MT385847. An RT-PCR assay was designed, targeting SnIV1 RNA2 (Ilar_RNA2_402F: CTATCTGCCCGAAGGTCAAC, Ilar_RNA2_1161R: CCTATCAAGAGCGAGCAATGG). All samples tested positive for SnIV1 irrespective of symptom status, so SnIV1 appears to not be associated with specific symptoms in Charisma apricots. This study is the first to report the presence of PlVd-I in symptomatic apricots presenting with uneven, indented surface morphology in South Africa. This study adds toward the investigation into possible alternative hosts for PlVd-I and will assist the South African certification scheme to assess the incidence and severity in apricots.
FROM:https://apsjournals.apsnet.org/doi/10.1094/PDIS-10-22-2321-PDN